View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9595A_low_232 (Length: 241)
Name: NF9595A_low_232
Description: NF9595A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9595A_low_232 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 1 - 234
Target Start/End: Complemental strand, 37304463 - 37304230
Alignment:
| Q |
1 |
tcacttgaggattgaaaattctcgccttcgagaagagatatacattcatcgcattgattcaaaaactacaccaagtttatggtgcgattgatagacacat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37304463 |
tcacttgaggattgaaaattctcgccttcgagaagaggtatacattcatcgcattgattcaaaaactacaccaagtttatggtgcgattgatagacacat |
37304364 |
T |
|
| Q |
101 |
atatcgagaccaatctggttgaactaaatgcggttaaaaaatgagataacaaatacattcgaggtcttggatcccctacaacagttgcacggtgcagcaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
37304363 |
atatcgagaccaatctggttgaactaaatgcggttaaaaaatgagataacaaatacattcgaggtcttggatcccctacaacagttgcacggtgcaacaa |
37304264 |
T |
|
| Q |
201 |
cgctattgtaggggatcaaaacctatattcttcg |
234 |
Q |
| |
|
| ||||||||||||||| ||||||||||| |||| |
|
|
| T |
37304263 |
cactattgtaggggatcgaaacctatatttttcg |
37304230 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University