View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9595A_low_237 (Length: 240)
Name: NF9595A_low_237
Description: NF9595A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9595A_low_237 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 163; Significance: 3e-87; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 23 - 200
Target Start/End: Complemental strand, 42492565 - 42492390
Alignment:
| Q |
23 |
gtgtactatcatggaaaattgttataatcatttttaaaaaacttcgttgaatataactatatcttatgaaagagcgacacatgtggacaaggaaatttgc |
122 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42492565 |
gtgtactatcgtggaaaattgttataatcatttttaaaaaacttcgttgaatataactatatcttatgaaagagcgacacatgtggacaaggaaatttgc |
42492466 |
T |
|
| Q |
123 |
aagaaaaattaaaacatggaccaccatcaataggatcgcccataaacctttttcctaacaaagttaaataattaagaa |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
42492465 |
aagaaaaattaaaacatggaccaccatcaataggatcgcccataaacctttttcctaac--agttaaataattaagaa |
42492390 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University