View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9595A_low_240 (Length: 239)
Name: NF9595A_low_240
Description: NF9595A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9595A_low_240 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 94; Significance: 5e-46; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 94; E-Value: 5e-46
Query Start/End: Original strand, 125 - 218
Target Start/End: Complemental strand, 48047418 - 48047325
Alignment:
| Q |
125 |
tatagtgaggaaaatgaaattggagaagactgataaccaacctcatcatcgtgtaatcttcaaattgagagttgtgaattgtgatatactaact |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48047418 |
tatagtgaggaaaatgaaattggagaagactgataaccaacctcatcatcgtgtaatcttcaaattgagagttgtgaattgtgatatactaact |
48047325 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 20 - 65
Target Start/End: Complemental strand, 48047526 - 48047481
Alignment:
| Q |
20 |
aatatgaaggtggaattgcatattgagatgaaaatgttggtatatt |
65 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48047526 |
aatatgaaggtggaattgcatattgagatgaaaatgttggtatatt |
48047481 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 32 - 60
Target Start/End: Complemental strand, 48039186 - 48039158
Alignment:
| Q |
32 |
gaattgcatattgagatgaaaatgttggt |
60 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
48039186 |
gaattgcatattgagatgaaaatgttggt |
48039158 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University