View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9595A_low_244 (Length: 238)
Name: NF9595A_low_244
Description: NF9595A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9595A_low_244 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 45; Significance: 9e-17; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 23 - 82
Target Start/End: Original strand, 31133640 - 31133700
Alignment:
| Q |
23 |
atattgcaaacaggaaatcaaacacac-ctacgctatgaaagaaatagacaacaaacaaac |
82 |
Q |
| |
|
||||||||||||||||||||||||||| || |||||||||| ||||||||||||||||||| |
|
|
| T |
31133640 |
atattgcaaacaggaaatcaaacacacactgcgctatgaaacaaatagacaacaaacaaac |
31133700 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 196 - 237
Target Start/End: Original strand, 31133807 - 31133848
Alignment:
| Q |
196 |
gagattacatactacaatccactatttacttacgagttacat |
237 |
Q |
| |
|
|||||||||| || |||||||||||||||||| ||||||||| |
|
|
| T |
31133807 |
gagattacattctccaatccactatttacttatgagttacat |
31133848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University