View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9595A_low_250 (Length: 236)
Name: NF9595A_low_250
Description: NF9595A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9595A_low_250 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 158; Significance: 3e-84; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 23 - 219
Target Start/End: Complemental strand, 30737742 - 30737545
Alignment:
| Q |
23 |
acgtagtaatctcaacaagtttgtgcatttatcaagaaggtatttcttgatgcaaatttgacacacttaaatagagtctttctctatgctgaagtggagg |
122 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||| | |
|
|
| T |
30737742 |
acgtagtaatctcaacaagtttctgcatttatcaagaaggtatttcttgatgtaaatttgacacacttaaatagaggctttctctatgctgaagtggacg |
30737643 |
T |
 |
| Q |
123 |
aatctgatatctgagtgaaggatcttcacagacatgacttattatgcttgggtcaaggcataatttaacat-gatgtatataaaacatctatgatact |
219 |
Q |
| |
|
| |||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||| |||||||||||||||||||||||||| |
|
|
| T |
30737642 |
agtctgatatatgagtgaaggatcttcacagacatgacttattatgcttgagtcaaggcataagttaacatggatgtatataaaacatctatgatact |
30737545 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University