View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9595A_low_254 (Length: 235)
Name: NF9595A_low_254
Description: NF9595A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9595A_low_254 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 55; Significance: 1e-22; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 27 - 89
Target Start/End: Original strand, 30715916 - 30715978
Alignment:
| Q |
27 |
attggtgtttattaatcaatattgtagatattgtcaatacatgtagtggtgttgtcctagttt |
89 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||| |
|
|
| T |
30715916 |
attggtgtttattaatcaatattgtagatattgttaatatatgtagtggtgttgtcctagttt |
30715978 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 60 - 118
Target Start/End: Original strand, 30734369 - 30734427
Alignment:
| Q |
60 |
tcaatacatgtagtggtgttgtcctagtttaaatcgtgctcaaaatttatatggtgggt |
118 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||| ||||||||||| ||||||||||| |
|
|
| T |
30734369 |
tcaatatatgtagtggtgttgtcctagtttaaattgtgctcaaaatgaatatggtgggt |
30734427 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 75 - 143
Target Start/End: Original strand, 30716028 - 30716097
Alignment:
| Q |
75 |
gtgttgtcctagtttaaatcgtgctcaaaatttatatggtgggtgttgatgagtttg-aatatgatgatc |
143 |
Q |
| |
|
||||||||||||||||||| ||||||||||| ||| ||||||||||||||| |||| |||||||||||| |
|
|
| T |
30716028 |
gtgttgtcctagtttaaattgtgctcaaaatgaataaggtgggtgttgatgaatttgaaatatgatgatc |
30716097 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University