View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9595A_low_257 (Length: 234)
Name: NF9595A_low_257
Description: NF9595A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9595A_low_257 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 1 - 229
Target Start/End: Original strand, 18260096 - 18260325
Alignment:
| Q |
1 |
agcatctggagttttagggatcaagataagagagtttgcattgtagttgggaaggagcgatccagtcttgaagaattctaccacagcttcatacacatct |
100 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18260096 |
agcatatggagttttagggatcaagataagagagtttgcattgtagttgggaaggagccatccagtcttgaagaattctaccacagcttcatacacatct |
18260195 |
T |
|
| Q |
101 |
ttctgaactatatcccaataggtttggaaaaagcaagcaccaaa-ccatgaggccctggtgcaccatcatgattcaaataaaaaatagcatttttaactt |
199 |
Q |
| |
|
|||| |||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18260196 |
ttcttaactatattccaataggtttggaaaaagcaagcaccaaacccatgaggccctggtgcaccatcatgattcaaataaaaaatagcatttttaactt |
18260295 |
T |
|
| Q |
200 |
cacttggattaggaatattagtgggaatct |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
18260296 |
cacttggattaggaatattagtgggaatct |
18260325 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University