View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9595A_low_276 (Length: 230)
Name: NF9595A_low_276
Description: NF9595A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9595A_low_276 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 66; Significance: 3e-29; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 130 - 227
Target Start/End: Original strand, 30735188 - 30735285
Alignment:
| Q |
130 |
cttaaatggttaagaaattggtttgttaaaaggttgttgtcatattcttatgatcatatcttaattaataaatacaatgcattataataaataggtgt |
227 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||| | | |||||||||||||| ||||||||||| |||||||||| ||||||| |
|
|
| T |
30735188 |
cttaaatggttaagaaattggtttgttaaaaggttgttgtcatgttcctctaatcatatcttaattgataaatacaatatattataataagtaggtgt |
30735285 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 4 - 79
Target Start/End: Original strand, 30735060 - 30735137
Alignment:
| Q |
4 |
gacaacaagcaattaaataattcat--acatagctatttcactagttatagttatcggtgtataataaagtagcatgg |
79 |
Q |
| |
|
|||||||||| ||||||||||||| |||||||||||||||||||||| |||||| ||||||||||||||||||||| |
|
|
| T |
30735060 |
gacaacaagcggttaaataattcattcacatagctatttcactagttattgttatctgtgtataataaagtagcatgg |
30735137 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University