View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9595A_low_292 (Length: 228)
Name: NF9595A_low_292
Description: NF9595A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9595A_low_292 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 18 - 210
Target Start/End: Original strand, 2815310 - 2815502
Alignment:
| Q |
18 |
atcaaatcaagaaagtagggaacatgagaaaacctgagtgaaactgaaacaccccataaacctgagaaagacgaaggctggtgcgatgggagttggaagc |
117 |
Q |
| |
|
||||||||||||||| ||||||| | |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||| |
|
|
| T |
2815310 |
atcaaatcaagaaagcagggaacgtaagaaaacctgagtgaaactgaaacaccccataaacctgagaaggacgaaggctggtgcggtgggagttggaagc |
2815409 |
T |
 |
| Q |
118 |
actgtagccggcgccgacgacaatctcatgtcgaagcactgttcaccgttttccccctttacttttcacccaaagccatccgagattttgttc |
210 |
Q |
| |
|
||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||| |
|
|
| T |
2815410 |
actgtagccggcggcgacaacaatctcatgtcgaagcactgttcaccgttttccccctttactgttcaccgaaagccatccgagattttgttc |
2815502 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University