View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9595A_low_297 (Length: 227)
Name: NF9595A_low_297
Description: NF9595A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9595A_low_297 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 85; Significance: 1e-40; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 81 - 202
Target Start/End: Complemental strand, 33092559 - 33092442
Alignment:
| Q |
81 |
tctcagttgtgtgtcgcaggtctacttgatgaatgcatgtcttaagactatatatggagcaagaaattgtctcgcttgtcactaagcaaaagaagaatca |
180 |
Q |
| |
|
|||||||||||||||| | ||||||||||||||||||||||||||||||||| |||||| ||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
33092559 |
tctcagttgtgtgtcgaatgtctacttgatgaatgcatgtcttaagactata----gagcaaaaaattctctcgcttgtcactaagcaaaagaagaatca |
33092464 |
T |
|
| Q |
181 |
agtgaaatttgtgagagtccta |
202 |
Q |
| |
|
|||||||||||||||| ||||| |
|
|
| T |
33092463 |
agtgaaatttgtgagaatccta |
33092442 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 81 - 195
Target Start/End: Complemental strand, 1182284 - 1182174
Alignment:
| Q |
81 |
tctcagttgtgtgtcgcaggtctacttgatgaatgcatgtcttaagactatatatggagcaagaaattgtctcgcttgtcactaagcaaaagaagaatca |
180 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||| |||||||||| ||| ||||||||||||||| |||||| |
|
|
| T |
1182284 |
tctcagttgtgtgtcgaaggtctacttgatgaatgcatgtcttaagactat----ggagcaaaaaattgtctcacttttcactaagcaaaagacgaatca |
1182189 |
T |
|
| Q |
181 |
agtgaaatttgtgag |
195 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
1182188 |
agtgaaatttgtgag |
1182174 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 37 - 83
Target Start/End: Complemental strand, 33092648 - 33092602
Alignment:
| Q |
37 |
gttagattttgctttgagatccaataatatgatgatgtgaacattct |
83 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33092648 |
gttagattttgctttgagatccaataatatgatgatgtgaacattct |
33092602 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University