View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9595A_low_310 (Length: 223)
Name: NF9595A_low_310
Description: NF9595A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9595A_low_310 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 3271964 - 3271742
Alignment:
| Q |
1 |
tattagattctttggctcacagctcagcattgcgttttgtgcttgtttttaacatttgttccatgcattcaccgtttgtccaaatgttagaacatctgct |
100 |
Q |
| |
|
|||||||||||||| ||||||||||||||| |||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
3271964 |
tattagattctttgtctcacagctcagcatagcgttttgtgtttgtttttaacatttgttccatgtattcaccgtttgtccaaatgttagaacatctgct |
3271865 |
T |
|
| Q |
101 |
taaattcaatgtcttaaacaattgtctctatgtgatggaagagtatatattgatcattcacagaggtccagattggatttcaataccattacaaattgaa |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
3271864 |
taaattcaatgtcttaaacaattgtctctatgtgatggaagagtatatattgatcattcacagagctccagattggatttcaataccattacaaattgaa |
3271765 |
T |
|
| Q |
201 |
tatgataccataaatgatagtaa |
223 |
Q |
| |
|
|| |||||||||||||||||||| |
|
|
| T |
3271764 |
taggataccataaatgatagtaa |
3271742 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University