View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9595A_low_312 (Length: 222)
Name: NF9595A_low_312
Description: NF9595A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9595A_low_312 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 43953634 - 43953855
Alignment:
| Q |
1 |
ggtttaatggcagcggctactaaacaagtgccaagagaaattcatggacggactaacttaagtcaaattgtgttggacacaaacaagtgcatattcggat |
100 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43953634 |
ggtttaatggcggcggctactaaacaagtgccaagagaaattcatggacggactaacttaagtcaaattgtgttggacacaaacaagtgcatattcggat |
43953733 |
T |
 |
| Q |
101 |
ggatccaatgagacatatctatccaacaaaaggtggtggttaataaacaagtaccattataattgcccatgctgttggcaaaaaggcaaggagactagca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43953734 |
ggatccaatgagacatatctatccaacaaaaggtggtggttaataaacaagtaccattataattgcccatgctgttggcaaaaaggcaaggagactagca |
43953833 |
T |
 |
| Q |
201 |
aagatgtctccaacagtgaggc |
222 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
43953834 |
aagatgtctccaacagtgaggc |
43953855 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University