View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9595A_low_323 (Length: 219)

Name: NF9595A_low_323
Description: NF9595A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9595A_low_323
NF9595A_low_323
[»] chr5 (1 HSPs)
chr5 (20-199)||(43098816-43098995)


Alignment Details
Target: chr5 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 20 - 199
Target Start/End: Original strand, 43098816 - 43098995
Alignment:
20 aaactagctgtaacaacgtcaggcaaaagagacaagtttgggcagcatttaataaagttcgaaaactagaacatgtaacagacgaacagcagcttgcaaa 119  Q
    |||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||    
43098816 aaactagctgtaacaatgtcaggcaaaagagacaagtttggtcagcatttaataaagttcgaaaactagaacatgtaacagactaacagctgcttgcaaa 43098915  T
120 atgcaaaatcatatagtactactgtctaaaacttgtatgtcaggtctagctcaccatttgatgacacttacattagtata 199  Q
    |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43098916 atgcaaaatcatatagtactaccgtctaaaacttgtatgtcaggtctagctcaccatttgatgacacttacattagtata 43098995  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University