View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9595A_low_325 (Length: 218)
Name: NF9595A_low_325
Description: NF9595A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9595A_low_325 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 1 - 218
Target Start/End: Complemental strand, 2727699 - 2727482
Alignment:
| Q |
1 |
tgtcagtcgatcataattgttcgatcatgtaaaagtttgacgcccattatatcaaattaaaagtcagacaaatgtgatggtttgtgatcggttgacgcta |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2727699 |
tgtcagtcgatcataattgttcgatcatgtaaaagtttgacttccattatatcaaattaaaagtcagacaaatgtgatggtttgtgatcggttgacgcta |
2727600 |
T |
|
| Q |
101 |
tagaaatttttattctgatagtacataaaaattattctctaagtaatgagttagttgttatgatttgtttgaataaaaaggttatttaagcacttattag |
200 |
Q |
| |
|
|||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
2727599 |
tagaaagttttacactgatagtacataaaaattattctctaagtaatgagttagttgttatgatttgtttgaataaaaaggttaattaagcacttattag |
2727500 |
T |
|
| Q |
201 |
attagtgttgatgtatag |
218 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
2727499 |
attagtgttgatgtatag |
2727482 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University