View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9595A_low_337 (Length: 213)
Name: NF9595A_low_337
Description: NF9595A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9595A_low_337 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 1 - 213
Target Start/End: Original strand, 38322621 - 38322833
Alignment:
| Q |
1 |
gtacaaccctgattggcaaaaagtgcaggttcatttttctatactaaatggtcaatgtaatcatatttatgaacttatgatcttattaattaatagtagc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38322621 |
gtacaaccctgattggcaaaaagtgcaggttcatttttctatactatatggtcaatgtaatcatatttatgaacttatgatcttattaattaatagtagc |
38322720 |
T |
|
| Q |
101 |
aaataatgttgaatgtatttgtgcagctgaaagaaaacaaaggatatcgacttgtcgaaagtgatgctcaaatgaatgcctcaatttcagaatctaaagt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||| |
|
|
| T |
38322721 |
aaataatgttgaatgtatttgtgcagctgaaagaaaacaaaggatatcgacttgtcgaaagtaatgctcaaataaatgcctcaatttcagaatctaaagt |
38322820 |
T |
|
| Q |
201 |
ccatacttcagag |
213 |
Q |
| |
|
|||| |||||||| |
|
|
| T |
38322821 |
ccatccttcagag |
38322833 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University