View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9595A_low_340 (Length: 209)
Name: NF9595A_low_340
Description: NF9595A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9595A_low_340 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 166; Significance: 5e-89; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 166; E-Value: 5e-89
Query Start/End: Original strand, 24 - 189
Target Start/End: Original strand, 35206363 - 35206528
Alignment:
| Q |
24 |
tctttctcctgtttttggacatgtcatgtttcctgctttaaaccatttttgaattgaggttctgttgtatgtttggccagtggaaacagttacaggatct |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35206363 |
tctttctcctgtttttggacatgtcatgtttcctgctttaaaccatttttgaattgaggttctgttgtatgtttggccagtggaaacagttacaggatct |
35206462 |
T |
 |
| Q |
124 |
gtcattagttccagagaaatcggacaacggtaatcatccggtgttatgtagtttaacatctctgct |
189 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35206463 |
gtcattagttccagagaaatcggacaacggtaatcatccggtgttatgtagtttaacatctctgct |
35206528 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 31 - 152
Target Start/End: Original strand, 43986069 - 43986190
Alignment:
| Q |
31 |
cctgtttttggacatgtcatgtttcctgctttaaaccatttttgaattgaggttctgttgtatgtttggccagtggaaacagttacaggatctgtcatta |
130 |
Q |
| |
|
|||||||| || ||||| ||||||||||||||| |||| | |||||||| | | | ||| ||||| || || ||||| ||||| ||||| ||||||| |
|
|
| T |
43986069 |
cctgttttagggcatgttttgtttcctgctttaagccatgtctgaattgaagcacgatcgtaggtttgtcctgttgaaactgttactggatcagtcatta |
43986168 |
T |
 |
| Q |
131 |
gttccagagaaatcggacaacg |
152 |
Q |
| |
|
|||| || ||||| |||||||| |
|
|
| T |
43986169 |
gttcgagtgaaattggacaacg |
43986190 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University