View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9595A_low_343 (Length: 208)
Name: NF9595A_low_343
Description: NF9595A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9595A_low_343 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
| [»] chr3 (2 HSPs) |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 53; Significance: 1e-21; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 144 - 208
Target Start/End: Original strand, 17894922 - 17894986
Alignment:
| Q |
144 |
aacctaaattatgaacataaaatgtcttttattttatgagaggaagaggtagatgaagatgatga |
208 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||| |||| |
|
|
| T |
17894922 |
aacctaaattatgaacacaaaatgtcttttattttatgagaggaagaggtagatggagataatga |
17894986 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 53; Significance: 1e-21; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 144 - 208
Target Start/End: Original strand, 6445066 - 6445130
Alignment:
| Q |
144 |
aacctaaattatgaacataaaatgtcttttattttatgagaggaagaggtagatgaagatgatga |
208 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||| |||| |
|
|
| T |
6445066 |
aacctaaattatgaacacaaaatgtcttttattttatgagaggaagaggtagatggagataatga |
6445130 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 144 - 190
Target Start/End: Complemental strand, 37187648 - 37187602
Alignment:
| Q |
144 |
aacctaaattatgaacataaaatgtcttttattttatgagaggaaga |
190 |
Q |
| |
|
|||||||||||||| || ||||||||||||||||||||||| ||||| |
|
|
| T |
37187648 |
aacctaaattatgagcacaaaatgtcttttattttatgagatgaaga |
37187602 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 45; Significance: 8e-17; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 144 - 208
Target Start/End: Complemental strand, 4749667 - 4749603
Alignment:
| Q |
144 |
aacctaaattatgaacataaaatgtcttttattttatgagaggaagaggtagatgaagatgatga |
208 |
Q |
| |
|
||||||||||||||||| |||||||||||| |||| | |||||||||||||||||||||| |||| |
|
|
| T |
4749667 |
aacctaaattatgaacacaaaatgtcttttttttttttagaggaagaggtagatgaagataatga |
4749603 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University