View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9595A_low_347 (Length: 206)
Name: NF9595A_low_347
Description: NF9595A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9595A_low_347 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 21 - 206
Target Start/End: Original strand, 40225396 - 40225581
Alignment:
| Q |
21 |
agctatagcaccaaatatataagtggaggaaaaaattacttacaaaaattgaccaagaacgtgggcgtaacgtaaggtttgagtttaatgagagaatgat |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40225396 |
agctatagcaccaaatatataagtggaggaaaaaattacttacaaaaattgaccaagaacgtgggcgtaacgtaaggtttgagtttaatgagagaatgat |
40225495 |
T |
 |
| Q |
121 |
ggtgaaaagacaaagctatttcttaaccaagcttcaatgaatttttgtaatggaagaagggaacagagatgaaaggataagggtat |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40225496 |
ggtgaaaagacaaagctatttcttaaccaagcttcaatgaatttttgtaatggaagaagggaacagagatgaaaggataagggtat |
40225581 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University