View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9595A_low_353 (Length: 203)
Name: NF9595A_low_353
Description: NF9595A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9595A_low_353 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 123; Significance: 2e-63; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 123; E-Value: 2e-63
Query Start/End: Original strand, 25 - 195
Target Start/End: Complemental strand, 25719315 - 25719144
Alignment:
| Q |
25 |
taccaacatgatcatgcaaacatacatgataaagattttaacgttacgattgaatctgatatagtgttgtgtagttaaatgcc-gtcatggcggaaatgg |
123 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
25719315 |
taccaacatgatcatgcaatcatacatgataaagattttaacgttatgattgaatctgatatagtgttgtgtagttaaatgccagtcatggcggaaatgg |
25719216 |
T |
|
| Q |
124 |
tatggtagnnnnnnngacaactgccacggacaattttcaaagggatgtccagcactacccctatcaacacca |
195 |
Q |
| |
|
||||| || |||||| ||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
25719215 |
tatggcagtttttttgacaaccgccacggacaattttcaaagggatgtccagcactacctctatcaacacca |
25719144 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University