View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9595A_low_356 (Length: 202)
Name: NF9595A_low_356
Description: NF9595A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9595A_low_356 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 128; Significance: 2e-66; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 128; E-Value: 2e-66
Query Start/End: Original strand, 3 - 150
Target Start/End: Complemental strand, 40456787 - 40456640
Alignment:
| Q |
3 |
atcacatgtgataccaattagtccttgaacaaatgacaacaagaatgaatcttagggtcagaattctatctctttactggttatttctgtacatatgtgg |
102 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||| ||||||||||||||| |||||||| |
|
|
| T |
40456787 |
atcacatgtgataccaattagtccttgaacaaatgacaacaagaaggaatcttagggtcagaattccatctctttgctggttatttctgtatatatgtgg |
40456688 |
T |
|
| Q |
103 |
tttgtaagtggttgaatttgtatgtttactttctcttgccagtagatt |
150 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
40456687 |
tttgtaagtggttgaatttggatgtttactttctcttgccagtagatt |
40456640 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 55; E-Value: 8e-23
Query Start/End: Original strand, 88 - 150
Target Start/End: Complemental strand, 40482148 - 40482086
Alignment:
| Q |
88 |
tctgtacatatgtggtttgtaagtggttgaatttgtatgtttactttctcttgccagtagatt |
150 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
40482148 |
tctgtatatatgtggtttgtaagtggttgaatttggatgtttactttctcttgccagtagatt |
40482086 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 3 - 47
Target Start/End: Original strand, 40362953 - 40362997
Alignment:
| Q |
3 |
atcacatgtgataccaattagtccttgaacaaatgacaacaagaa |
47 |
Q |
| |
|
|||| |||||||||||||||||||||| |||||||| ||| |||| |
|
|
| T |
40362953 |
atcaaatgtgataccaattagtccttgcacaaatgataactagaa |
40362997 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University