View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9595A_low_50 (Length: 367)
Name: NF9595A_low_50
Description: NF9595A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9595A_low_50 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 309; Significance: 1e-174; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 309; E-Value: 1e-174
Query Start/End: Original strand, 12 - 348
Target Start/End: Complemental strand, 17936078 - 17935742
Alignment:
| Q |
12 |
gaagtggaagacaaacaagaagaagtgttggaggtggcaaggttcaattatggtggtgttgccgcgactactaagaaatcgccaccacgatctttccctc |
111 |
Q |
| |
|
||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
17936078 |
gaagtggaagacaaagaacaagaagtgttggaggtggcaaggttcaattatggtggtgttgccgcgactactaagaaatcaccaccacgatctttccctc |
17935979 |
T |
|
| Q |
112 |
caccacttccttcactttctcgccaagacggtccttcttttcaaatgaggccacaccgcgacaacggaaggttggttctagaagctgtgtctcttccttc |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| || | |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17935978 |
caccacttccttcactttctcgccaagacggtccttcttttcaaatgaggccacccccccacaacggaaggttggttctagaagctgtgtctcttccttc |
17935879 |
T |
|
| Q |
212 |
attgaacaacttctgtgttcaacgccaagatggtagacttgtcctcacttttgcaaatcaagaccaagaaattggtgagaatgatgagaaagaaaatgat |
311 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17935878 |
attgaacaacttctgtgttcaacgccaagatggtagacttgtcctcacttttgcaaatcaagaccaagaaattggtgagaatgatgagaaagaaaatgat |
17935779 |
T |
|
| Q |
312 |
ggagtaggtgaattggaggaagagtttgaagggtttg |
348 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
17935778 |
ggagtaggtgaattggaagaagagtttgaagggtttg |
17935742 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University