View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9595A_low_66 (Length: 347)
Name: NF9595A_low_66
Description: NF9595A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9595A_low_66 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 319; Significance: 1e-180; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 319; E-Value: 1e-180
Query Start/End: Original strand, 21 - 347
Target Start/End: Complemental strand, 32473071 - 32472745
Alignment:
| Q |
21 |
acaatctaccccaacacaccttccatcatctacaacgacaccgttttcacatggtctcaaacccacaaacgatgcctccaacttgcctccgccatcacct |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32473071 |
acaatctaccccaacacaccttccatcatctacaacgacaccgttttcacatggtctcaaacccacaaacgatgcctccaacttgcctccgccatcacct |
32472972 |
T |
 |
| Q |
121 |
ccttaggtatccgccgcggcaacgtcgtctccgtcatcgctcccaacatccccgccatgtatgaactccacttcgccgttcccttcaccggagctatcct |
220 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
32472971 |
ccttaggtatccgccgcggcaacgtcgtctccgtcatcgctcccaacatccccgccatgtatgaactccacttcgccgtccccttcaccggagctatcct |
32472872 |
T |
 |
| Q |
221 |
taacaacatcaacacgcgccttgacgcgcgtatcatctccaacatcctcctccactgcgaatccaaactcgttttcgtagatatcgccgcacgtgatctt |
320 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
32472871 |
taacaacatcaacacgcgccttgacgcgcgtatcatctccaacatcctcctccactgcgaatccaaactcgttttcgtggatatcgccgcacgtgatctt |
32472772 |
T |
 |
| Q |
321 |
gttctccaagctttatccttattccct |
347 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
32472771 |
gttctccaagctttatccttattccct |
32472745 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University