View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9595A_low_71 (Length: 345)
Name: NF9595A_low_71
Description: NF9595A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9595A_low_71 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 122; Significance: 2e-62; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 122; E-Value: 2e-62
Query Start/End: Original strand, 143 - 276
Target Start/End: Complemental strand, 1676552 - 1676419
Alignment:
| Q |
143 |
aaaagtaaatatgtgatgataatcacaaaaaattactatttttcaaaaacaaacaacatatttaaaagataattataaacatggcttataactgggagtt |
242 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
1676552 |
aaaagtaaatatgtgatgatgatcacaaaaaattactatttttcaaaaacaaacaacatattttaaagataattataaacatggcttataactgggagtt |
1676453 |
T |
|
| Q |
243 |
gggtcttacccatctcgaggttgttcatttcagt |
276 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||| |
|
|
| T |
1676452 |
gggtcttacccatctcgaggttgttcttttcagt |
1676419 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University