View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9595A_low_75 (Length: 340)
Name: NF9595A_low_75
Description: NF9595A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9595A_low_75 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 318; Significance: 1e-179; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 318; E-Value: 1e-179
Query Start/End: Original strand, 1 - 334
Target Start/End: Complemental strand, 36170709 - 36170376
Alignment:
| Q |
1 |
gtcgaagaaaatatagcaactgatccacaaaaccataactcattaaaatacttacagagctagatgaagtaaaacacaaactttcaatagccctcattgt |
100 |
Q |
| |
|
|||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36170709 |
gtcgaacataatatagcaactgatccacaaaaccataactcattaaaatacttacagagctagatgaagtaaaacacaaactttcaatagccctcattgt |
36170610 |
T |
|
| Q |
101 |
tatttcctttgtttttgaagaatatgaccatttcggatctaaaacacgtaacaaagcacggattccgccttctctaatcaccgtttgcctaaccaactca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
36170609 |
tatttcctttgtttttgaagaatatgaccatttcggatctaaaacacgtaacaaagcacggattccgccttctctaatcaccatttgcctaaccaactca |
36170510 |
T |
|
| Q |
201 |
tctccaaaggcaatattctgaatgaaccctattgaattcacctgaattgcttcctcctttgatttcactagcctgataaaagtcgacaccgcatcctcct |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36170509 |
tctccaaaggcaatattctgaatgaaccctattgaattcacctgaattgcttcctcctttgatttcactagcctgataaaagtcgacaccgcatcctcct |
36170410 |
T |
|
| Q |
301 |
caaccataaatctcttaacttcctcaacaccaac |
334 |
Q |
| |
|
||||||| |||||||||||||||||||||||||| |
|
|
| T |
36170409 |
caaccatgaatctcttaacttcctcaacaccaac |
36170376 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 54; E-Value: 6e-22
Query Start/End: Original strand, 1 - 62
Target Start/End: Original strand, 1286333 - 1286394
Alignment:
| Q |
1 |
gtcgaagaaaatatagcaactgatccacaaaaccataactcattaaaatacttacagagcta |
62 |
Q |
| |
|
|||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1286333 |
gtcgaacataatatagcaactgatccacaaaaccataactcattaaaatacttacagagcta |
1286394 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University