View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9595A_low_80 (Length: 327)
Name: NF9595A_low_80
Description: NF9595A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9595A_low_80 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 303; Significance: 1e-170; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 303; E-Value: 1e-170
Query Start/End: Original strand, 11 - 321
Target Start/End: Complemental strand, 6041011 - 6040701
Alignment:
| Q |
11 |
gagttcgacaaaagcagcacctgcctcaccacaaaaacagcatcccttggtgagaacaactccagatggttcaccaaattacatgaagccaactagcagt |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
6041011 |
gagttcgacaaaagcagcacctgcctcaccacaaaaacagcatcccttggtgagaacaactccagatggttcaccaaattacatgaagccaacaagcagt |
6040912 |
T |
 |
| Q |
111 |
tcacatgcaaagaaggaacttttctctgtaagtcttagaaaaactcaatctggttctgattttaatagaaaatattcaagtgattcaaaagctttatgta |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6040911 |
tcacatgcaaagaaggaacttttctctgtaagtcttagaaaaactcaatctggttctgattttaatagaaaatattcaagtgattcaaaagctttatgta |
6040812 |
T |
 |
| Q |
211 |
agaagcctacaaaagctttgataagatcaagtagtttgagtttggttagaacattgacaaagactactagctttaaggcttctagaacttcttgtcctag |
310 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6040811 |
aaaagcctacaaaagctttgataagatcaagtagtttgagtttggttagaacattgacaaagactactagctttaaggcttctagaacttcttgtcctag |
6040712 |
T |
 |
| Q |
311 |
aaaatcaacaa |
321 |
Q |
| |
|
||||||||||| |
|
|
| T |
6040711 |
aaaatcaacaa |
6040701 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University