View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9596_high_4 (Length: 217)

Name: NF9596_high_4
Description: NF9596
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9596_high_4
NF9596_high_4
[»] chr2 (1 HSPs)
chr2 (17-162)||(41367088-41367233)


Alignment Details
Target: chr2 (Bit Score: 138; Significance: 3e-72; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 17 - 162
Target Start/End: Complemental strand, 41367233 - 41367088
Alignment:
17 aaggtccctaagaacacaataattattgcaaaaattaccaagataggattggggcaaaaatttacccctttcatatccaccaactcttctaccttaacca 116  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||    
41367233 aaggtccctaagaacacaataattattgcaaaaattaccaagataggattggtgcaaaaatttacccctttcatatccaccaactcttctaccttaacca 41367134  T
117 tgtccctcaggattaatatcctcatcaaatttctcttattccttaa 162  Q
    ||||||||||||||||||||||||||||||| ||||||||||||||    
41367133 tgtccctcaggattaatatcctcatcaaattactcttattccttaa 41367088  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University