View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9596_low_15 (Length: 222)
Name: NF9596_low_15
Description: NF9596
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9596_low_15 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 146; Significance: 4e-77; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 146; E-Value: 4e-77
Query Start/End: Original strand, 35 - 215
Target Start/End: Original strand, 4115216 - 4115393
Alignment:
| Q |
35 |
tataactttaatattataacagtgcttttgtgtatttggcaacccgtttcttaatcaattccgttattaagcgttgatattgcaatgcacgagtggttta |
134 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4115216 |
tataactttaatattataacagtgcttttgtgtatttggcaacccgttttttaatcaattccgttattaagcgttgatattgcaatgcacgagtggttta |
4115315 |
T |
|
| Q |
135 |
tttccggttatatataaaccaaactgagagataccaaaattgttaggtcggacactatgatcggaatatgaacaacaccaa |
215 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||| |||||||||||||||||||| ||||||| || ||||||||||||| |
|
|
| T |
4115316 |
tttccggttatatataaaccaaac-gagagatactaaaattgttaggtcggacac--tgatcgggatttgaacaacaccaa |
4115393 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University