View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9596_low_19 (Length: 214)
Name: NF9596_low_19
Description: NF9596
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9596_low_19 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 122; Significance: 9e-63; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 122; E-Value: 9e-63
Query Start/End: Original strand, 20 - 206
Target Start/End: Original strand, 4115011 - 4115196
Alignment:
| Q |
20 |
gtatgagtactagtcctagaacttttagtagcatgagaagacaacacaataattaacttattgtagaaggttttgcaacnnnnnnnncaacattattttt |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
4115011 |
gtatgagtactagtcctagaacttttagtagcatgaaaagacaacacaatcattaacttattgtagaaggttttgcaacaaaaaaaa-aacattattttt |
4115109 |
T |
|
| Q |
120 |
gcaaaattttctttgacaatagtcnnnnnnnccagttctttgaattattgattatcgtcattaaggttttgaactataactttaata |
206 |
Q |
| |
|
||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4115110 |
gcaaaatcttctttgacaatagtctttttttccagttctttgaattattgattatcgtcattaaggttttgaactataactttaata |
4115196 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University