View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9596_low_9 (Length: 296)
Name: NF9596_low_9
Description: NF9596
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9596_low_9 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 186; Significance: 1e-101; HSPs: 4)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 72 - 286
Target Start/End: Complemental strand, 48085443 - 48085229
Alignment:
| Q |
72 |
ggacacagataaagaaaatacacacataaactaacnnnnnnncattaaccaaatgtcttggatggattgatcaagtcctggaatctaaggccatgatagt |
171 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48085443 |
ggacacagataaagaaaatacacacataaactaacaaaaaaacattaaccaaatgtcttggatggattgatcaagtcctggaatctaaggccatgatagt |
48085344 |
T |
|
| Q |
172 |
gctgagattcatgggatacatgtactgagcactgcccctaaggatttggttgactatgattttgtttgccttttcagatggatggaatgcatcccaaaat |
271 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48085343 |
gctgagattcatgggatacatgtactgagcactgcccctaaggattcggttgactatgattttgtttgccttttcagatggatggaatgcatcccaaaaa |
48085244 |
T |
|
| Q |
272 |
gcattaagttctctg |
286 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
48085243 |
gcattaagttctctg |
48085229 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 230 - 275
Target Start/End: Complemental strand, 48102536 - 48102491
Alignment:
| Q |
230 |
attttgtttgccttttcagatggatggaatgcatcccaaaatgcat |
275 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48102536 |
attttgtttgccttttcagatggatggaatgcatcccaaaatgcat |
48102491 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 19 - 52
Target Start/End: Complemental strand, 48085476 - 48085443
Alignment:
| Q |
19 |
gacaaaccactagctatggaatacaaaacaaaag |
52 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
48085476 |
gacaaaccactagctatggaatacaaaacaaaag |
48085443 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 236 - 271
Target Start/End: Complemental strand, 1809590 - 1809555
Alignment:
| Q |
236 |
tttgccttttcagatggatggaatgcatcccaaaat |
271 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||| |
|
|
| T |
1809590 |
tttgccttttcagatggatggaatggatcccaaaat |
1809555 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 44; Significance: 4e-16; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 233 - 276
Target Start/End: Original strand, 7385568 - 7385611
Alignment:
| Q |
233 |
ttgtttgccttttcagatggatggaatgcatcccaaaatgcatt |
276 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7385568 |
ttgtttgccttttcagatggatggaatgcatcccaaaatgcatt |
7385611 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 33; Significance: 0.000000002; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 223 - 275
Target Start/End: Original strand, 35357711 - 35357763
Alignment:
| Q |
223 |
gactatgattttgtttgccttttcagatggatggaatgcatcccaaaatgcat |
275 |
Q |
| |
|
|||||||||| || | || |||||||||||||| ||||||||||||||||||| |
|
|
| T |
35357711 |
gactatgattctgctagctttttcagatggatgaaatgcatcccaaaatgcat |
35357763 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 224 - 284
Target Start/End: Original strand, 35376267 - 35376327
Alignment:
| Q |
224 |
actatgattttgtttgccttttcagatggatggaatgcatcccaaaatgcattaagttctc |
284 |
Q |
| |
|
||||||||| || | || ||||||||||||||||||| |||||||||||||| ||| |||| |
|
|
| T |
35376267 |
actatgattctgctagctttttcagatggatggaatggatcccaaaatgcataaaggtctc |
35376327 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University