View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9597_low_2 (Length: 237)
Name: NF9597_low_2
Description: NF9597
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9597_low_2 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 169; Significance: 9e-91; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 169; E-Value: 9e-91
Query Start/End: Original strand, 15 - 220
Target Start/End: Original strand, 43959518 - 43959719
Alignment:
| Q |
15 |
aggtcaacatatgaatagtaaattagaagagactcgttttattataaataaaaatgatatgaataccaccattggtcactcacacatcaacttagttttc |
114 |
Q |
| |
|
||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||| |
|
|
| T |
43959518 |
aggtcaatatatcaatagtaaattagaagagactcgttttattataaataaaaatgatatgaataccaccattggtcac----acattaacttagttttc |
43959613 |
T |
|
| Q |
115 |
cctttgtttcattctctcacaagaaaaactcatacataataaggatggcgtgcacggagttatgtattgatttcaaaggacttctgatggtgctacttct |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43959614 |
cctttgtttcattctctcacaagaaaaactcatacataataaggatggcgtgcacagagttttgtattgatttcaaaggacttctgatggtgctacttct |
43959713 |
T |
|
| Q |
215 |
tgctct |
220 |
Q |
| |
|
|||||| |
|
|
| T |
43959714 |
tgctct |
43959719 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 155 - 220
Target Start/End: Original strand, 43963639 - 43963704
Alignment:
| Q |
155 |
aaggatggcgtgcacggagttatgtattgatttcaaaggacttctgatggtgctacttcttgctct |
220 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
43963639 |
aaggatggcgtgcacagagttatgtattgatttcacaggacttctgatggtgctacttcttgctct |
43963704 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University