View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9598_low_12 (Length: 218)
Name: NF9598_low_12
Description: NF9598
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9598_low_12 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 17 - 199
Target Start/End: Original strand, 52850863 - 52851045
Alignment:
| Q |
17 |
cacagaagtatacaattggcatggctcatatggacggatacaagagatttgaaccacataagagaaagtgctgcgcttgttgcaaagttggttggtttta |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52850863 |
cacagaagtatacaattggcatggctcatatggacggatacaagagatttgaaccacataagagaaagtgctgcgcttgttgcaaagttggttggtttta |
52850962 |
T |
 |
| Q |
117 |
ttaacacggccgagacctcaaagaaaacttttggatttggcttcttaagccgacgtaagagcataaaatcccttagttggaag |
199 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52850963 |
ttaacacgggtgagacctcaaagaaaacttttggatttggcttcttaagccgacgtaagagcataaaatcccttagttggaag |
52851045 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University