View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9599_low_6 (Length: 227)
Name: NF9599_low_6
Description: NF9599
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9599_low_6 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 11 - 210
Target Start/End: Original strand, 46185297 - 46185496
Alignment:
| Q |
11 |
gattattctcagactctaaaaaatagtagaacaattctgcgacattttcatctgtttcagtttcacccactcccacatacccagtttctagtacaaacgg |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
46185297 |
gattattctcagactctaaaaaatagtagaacaattccgcggaattttcatctgtttcagtttcacccactcccacatacccagtttctagtacaaaggg |
46185396 |
T |
 |
| Q |
111 |
aaggggtccttgaaaaccaggaagatacttcacaatattgaattgagatgtagcaaaaacaaggttggtggatgaattttgtaacaatagaaatattgct |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46185397 |
aaggggtccttgaaaaccaggaagatacttcacaatattgaattgagatgtagcaaaaacaaggttggtggatgaattttgtaacaatagaaatattgct |
46185496 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 89 - 136
Target Start/End: Complemental strand, 6992267 - 6992220
Alignment:
| Q |
89 |
acccagtttctagtacaaacggaaggggtccttgaaaaccaggaagat |
136 |
Q |
| |
|
|||||||||| ||| |||| ||||| |||||||||||||||||||||| |
|
|
| T |
6992267 |
acccagtttcaagttcaaaaggaagaggtccttgaaaaccaggaagat |
6992220 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University