View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9599_low_6 (Length: 227)

Name: NF9599_low_6
Description: NF9599
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9599_low_6
NF9599_low_6
[»] chr3 (1 HSPs)
chr3 (11-210)||(46185297-46185496)
[»] chr4 (1 HSPs)
chr4 (89-136)||(6992220-6992267)


Alignment Details
Target: chr3 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 11 - 210
Target Start/End: Original strand, 46185297 - 46185496
Alignment:
11 gattattctcagactctaaaaaatagtagaacaattctgcgacattttcatctgtttcagtttcacccactcccacatacccagtttctagtacaaacgg 110  Q
    ||||||||||||||||||||||||||||||||||||| |||  |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||    
46185297 gattattctcagactctaaaaaatagtagaacaattccgcggaattttcatctgtttcagtttcacccactcccacatacccagtttctagtacaaaggg 46185396  T
111 aaggggtccttgaaaaccaggaagatacttcacaatattgaattgagatgtagcaaaaacaaggttggtggatgaattttgtaacaatagaaatattgct 210  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
46185397 aaggggtccttgaaaaccaggaagatacttcacaatattgaattgagatgtagcaaaaacaaggttggtggatgaattttgtaacaatagaaatattgct 46185496  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 89 - 136
Target Start/End: Complemental strand, 6992267 - 6992220
Alignment:
89 acccagtttctagtacaaacggaaggggtccttgaaaaccaggaagat 136  Q
    |||||||||| ||| |||| ||||| ||||||||||||||||||||||    
6992267 acccagtttcaagttcaaaaggaagaggtccttgaaaaccaggaagat 6992220  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University