View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9601_low_13 (Length: 240)
Name: NF9601_low_13
Description: NF9601
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9601_low_13 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 130; Significance: 2e-67; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 1 - 218
Target Start/End: Original strand, 41892581 - 41892797
Alignment:
| Q |
1 |
tgcaggtttgaagtttgaatcctagatttatcacttctccgcacttaaagtgtgtgaatctagacataatactactagnnnnnnnnnnnnntgcaagttt |
100 |
Q |
| |
|
|||||||| |||||| |||||| |||||||||||||||| ||||||||||||||||||||||||| || |||||||| |||||| || |
|
|
| T |
41892581 |
tgcaggttcgaagttcgaatcccggatttatcacttctccacacttaaagtgtgtgaatctagacacaagactactagaaaaagaaaaag-tgcaagctt |
41892679 |
T |
|
| Q |
101 |
atgcggatgaaagaatttccgattgagaggtgagcacgatgaactcacgcttgagcgagagattgatgtgtagcgagtgtaagttagaacataaactcat |
200 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41892680 |
atgcggatgaaagaattttcgattgagaggtgagcacgatgaactcacacttgagcgagagattgatgtgtagcgagtgtaagttagaacataaactcat |
41892779 |
T |
|
| Q |
201 |
tgccttatattttaggtt |
218 |
Q |
| |
|
||||||| |||||||||| |
|
|
| T |
41892780 |
tgccttagattttaggtt |
41892797 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University