View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9602_low_3 (Length: 336)
Name: NF9602_low_3
Description: NF9602
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9602_low_3 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 63 - 308
Target Start/End: Original strand, 48575588 - 48575833
Alignment:
| Q |
63 |
cggttgtgtcagctgtgttctgttttgattggtgtagatgttgagcagttgatgtaaaatgagaatagatgtatatacttatcattgccttcttatggtg |
162 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48575588 |
cggttgtgtcagctgtgttctgttttgattggtgtagatgttgagcagttgatgtaaaatgagaatagatgtatatacttatcattgccttcttatggta |
48575687 |
T |
|
| Q |
163 |
atggaaattcaaatgttctcattaaattcataccgtatttgcaatggttcaaattggcccatccacgtgagtctcttcttgaaatcgaataaatatatat |
262 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
48575688 |
atgcaaattcaaatgttctcattaaattcataccgtatttgcaatgattcaaattggcccatccacgtgagtctcttcttgaaatcaaataaatatatat |
48575787 |
T |
|
| Q |
263 |
cgatatgaagtcggtgtaatcggtatagttttaattgcgtgaacat |
308 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48575788 |
cgatatgaagtcggtgtaatcggtatagttttaattgcgtgaacat |
48575833 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University