View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9602_low_9 (Length: 242)

Name: NF9602_low_9
Description: NF9602
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9602_low_9
NF9602_low_9
[»] chr7 (1 HSPs)
chr7 (44-224)||(48575308-48575488)


Alignment Details
Target: chr7 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 44 - 224
Target Start/End: Original strand, 48575308 - 48575488
Alignment:
44 agaggatggttatttcctgccgttgtatgttgttgctggtttctggttacagttttgcttgcgcgtttggctggaaccttttcagatggtgatggctttg 143  Q
    ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
48575308 agaggatggttattttctgccgttgtatgttgttgctggtttctggttacagttttgcttgcgcgtttggctggaaccttttcagatggtgatggctttg 48575407  T
144 attttgagcaaattgggtaggatactcaagccttggtggtgttttgattggtgatggtgttttgggaaatatatttggggc 224  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
48575408 attttgagcaaattgggtaggatactcaagccttggtggtgttttgattggtgatggtgttttgggaaatatatttggggc 48575488  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University