View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9602_low_9 (Length: 242)
Name: NF9602_low_9
Description: NF9602
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9602_low_9 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 44 - 224
Target Start/End: Original strand, 48575308 - 48575488
Alignment:
| Q |
44 |
agaggatggttatttcctgccgttgtatgttgttgctggtttctggttacagttttgcttgcgcgtttggctggaaccttttcagatggtgatggctttg |
143 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48575308 |
agaggatggttattttctgccgttgtatgttgttgctggtttctggttacagttttgcttgcgcgtttggctggaaccttttcagatggtgatggctttg |
48575407 |
T |
 |
| Q |
144 |
attttgagcaaattgggtaggatactcaagccttggtggtgttttgattggtgatggtgttttgggaaatatatttggggc |
224 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48575408 |
attttgagcaaattgggtaggatactcaagccttggtggtgttttgattggtgatggtgttttgggaaatatatttggggc |
48575488 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University