View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9603_high_3 (Length: 238)
Name: NF9603_high_3
Description: NF9603
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9603_high_3 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 157; Significance: 1e-83; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 54 - 222
Target Start/End: Complemental strand, 41854309 - 41854141
Alignment:
| Q |
54 |
ttgaaggtacgatgtgggtaatggtttttatgcgatagcagcacatacggatagtccttgtctgaaactgaagccgaaaacagcatcattgaaggcttct |
153 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
41854309 |
ttgaaggtatgatgtgggtaatggtttttatgcgatagcagcacatactgatagtccttgtctgaaactgaagccaaaaacagcatcattgaaggcttct |
41854210 |
T |
 |
| Q |
154 |
tcttatatgatggtaaatgttcagacttatggaggtgggttatggcatacttggtttgatagggatttg |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41854209 |
tcttatatgatggtaaatgttcagacttatggaggtgggttatggcatacttggtttgatagggatttg |
41854141 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 1 - 54
Target Start/End: Complemental strand, 41854397 - 41854344
Alignment:
| Q |
1 |
attttcctactgaaatagtagatgactcattcactcttgttattattatcttct |
54 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
41854397 |
attttccccctgaaatagtagatgactcattcactctttttattattatcttct |
41854344 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University