View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9603_low_10 (Length: 238)

Name: NF9603_low_10
Description: NF9603
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9603_low_10
NF9603_low_10
[»] chr1 (2 HSPs)
chr1 (54-222)||(41854141-41854309)
chr1 (1-54)||(41854344-41854397)


Alignment Details
Target: chr1 (Bit Score: 157; Significance: 1e-83; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 54 - 222
Target Start/End: Complemental strand, 41854309 - 41854141
Alignment:
54 ttgaaggtacgatgtgggtaatggtttttatgcgatagcagcacatacggatagtccttgtctgaaactgaagccgaaaacagcatcattgaaggcttct 153  Q
    ||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||    
41854309 ttgaaggtatgatgtgggtaatggtttttatgcgatagcagcacatactgatagtccttgtctgaaactgaagccaaaaacagcatcattgaaggcttct 41854210  T
154 tcttatatgatggtaaatgttcagacttatggaggtgggttatggcatacttggtttgatagggatttg 222  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
41854209 tcttatatgatggtaaatgttcagacttatggaggtgggttatggcatacttggtttgatagggatttg 41854141  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 1 - 54
Target Start/End: Complemental strand, 41854397 - 41854344
Alignment:
1 attttcctactgaaatagtagatgactcattcactcttgttattattatcttct 54  Q
    |||||||  ||||||||||||||||||||||||||||| |||||||||||||||    
41854397 attttccccctgaaatagtagatgactcattcactctttttattattatcttct 41854344  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University