View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9603_low_16 (Length: 216)
Name: NF9603_low_16
Description: NF9603
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9603_low_16 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 169; Significance: 8e-91; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 169; E-Value: 8e-91
Query Start/End: Original strand, 28 - 200
Target Start/End: Original strand, 1039178 - 1039350
Alignment:
| Q |
28 |
cttattctccaagaaacatcatgtttagattgaaaaaatatatatttaaaacagtaaaaggtttgcttgcgtttagaaccgtgaagagaattagggtacc |
127 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1039178 |
cttattctccaagaaacatcatgtttagattgaaaaaatatatatttaaaacagtaaaaggtttgcttgcgtttagaaccgtgaagagaattagggtacc |
1039277 |
T |
 |
| Q |
128 |
gtcgaaactcctcgctactcagctttatcacgatacggtacgttcttttcttcactgtttgaatctatctatt |
200 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1039278 |
gtcgaaactcctcgctactcagctttctcacgatacggtacgttcttttcttcactgtttgaatctatctatt |
1039350 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 155 - 195
Target Start/End: Original strand, 1045595 - 1045635
Alignment:
| Q |
155 |
tcacgatacggtacgttcttttcttcactgtttgaatctat |
195 |
Q |
| |
|
|||| ||| |||||| ||||||||||||||||||||||||| |
|
|
| T |
1045595 |
tcactataaggtacgatcttttcttcactgtttgaatctat |
1045635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University