View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9603_low_8 (Length: 241)
Name: NF9603_low_8
Description: NF9603
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9603_low_8 |
 |  |
|
| [»] chr1 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 155; Significance: 2e-82; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 71 - 241
Target Start/End: Complemental strand, 41855006 - 41854836
Alignment:
| Q |
71 |
tcatcaacgattctaacgatatccaccttgatccaatactagttgacagaggttgggtgtttgttatgagtgttgggactgagtttgaaacatcatggca |
170 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
41855006 |
tcatcaacgattctaacgatatccaccttgatgcaatactagttgacagaggttgggtgtttgttatgagtgttgggactaagtttgaaacatcatggca |
41854907 |
T |
 |
| Q |
171 |
tcaacaataactcgaccgcacattcttcttctgcattcttcatctccatcactcaaactcaatctcaaacc |
241 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
41854906 |
tcaacaataactcgaccgcacattctacttctgcactcttcatctccatcactcaaactcaatctcaaacc |
41854836 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 2 - 62
Target Start/End: Complemental strand, 41855115 - 41855055
Alignment:
| Q |
2 |
atgagatggacatcacataatgacttgttatttactcattaaacttattttttgggtcacc |
62 |
Q |
| |
|
|||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41855115 |
atgagacggatatcacataatgacttgttatttactcattaaacttattttttgggtcacc |
41855055 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University