View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9604_high_11 (Length: 235)
Name: NF9604_high_11
Description: NF9604
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9604_high_11 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 13 - 235
Target Start/End: Original strand, 28182316 - 28182536
Alignment:
| Q |
13 |
gtctccacatctcacacttgctattgtataggataatggatggattgctcttgtataacaatgacaagatttagtgcttaaccagtcaaagattgttgtt |
112 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28182316 |
gtctccacatctcacacttgcttttgtataggataatggatggattgctcttgtataacaatgacaagatttagtgcttaaccagtcaaagattgttgtt |
28182415 |
T |
 |
| Q |
113 |
aactaccaaatgttattattatatcacaaaatatgcttattctgttattcaattgaaaaagtttatgacttatgattcaatgnnnnnnnnntacttgttc |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
28182416 |
aactaccaaatgttattattatatcacaaaatatgcttattctattattcaattgaaaaagtttatgacttatgattcaatg--aaaaaaatacttgttc |
28182513 |
T |
 |
| Q |
213 |
aattggaaaaaatggtttccatt |
235 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
28182514 |
aattggaaaaaatggtttccatt |
28182536 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University