View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9604_high_5 (Length: 396)
Name: NF9604_high_5
Description: NF9604
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9604_high_5 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 336; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 336; E-Value: 0
Query Start/End: Original strand, 20 - 386
Target Start/End: Complemental strand, 52246253 - 52245884
Alignment:
| Q |
20 |
ttattcattgttttatgctatccattagttaatttttcaagattatttttgctttaattgtaatcagacattgcagaaaacccaacaaggctgtcaccgt |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
52246253 |
ttattcattgttttatgctatccattagttaatttttcaagattatttttgctttaattgtaatcagacattgcagaaaaccaaacaaggctgtcaccgt |
52246154 |
T |
 |
| Q |
120 |
cttcaaacgct---acttctactagctgttgttcttctttcagcagtctcatgtcaagcttgcctcactcagatatccccacatctttctctatcacaga |
216 |
Q |
| |
|
||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52246153 |
cttcaaacgcttctacttctactagcttttgttcttctttcagcagtctcatgtcaagcttgcctcactcagatatccccacatctttctctatcacaga |
52246054 |
T |
 |
| Q |
217 |
acccacaaccctctcacttttcacaccactctatctctccaataacagcaacaatgatcacccttttccccattacaatactgcatctccacaacctgta |
316 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52246053 |
acccacaaccctctcacttttcacaccactctatctctccaataacaacaacaatgatcacccttttccccattacaatactgcatctccacaacctgta |
52245954 |
T |
 |
| Q |
317 |
ttatctgctacagcattactccaaaaagctgctcaagtgggttcatcttcatccaatgcatctctgcttc |
386 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
52245953 |
ttatctgctactgcattactccaaaaagctgctcaagtgggttcatcttcatccaatgcatctttgcttc |
52245884 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University