View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9604_low_29 (Length: 270)
Name: NF9604_low_29
Description: NF9604
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9604_low_29 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 13 - 270
Target Start/End: Original strand, 2734661 - 2734918
Alignment:
| Q |
13 |
ataatacttaagtttgttgcaagcataaagtagcgatacaaataatttctcagtggatgtatatctagtctaagcatcattcaagattcggctaagtcca |
112 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
2734661 |
ataatacttaagtttgttgcaagcatagagtagcgatacaaataatttctcagtggatgtatatctagtctaagcatcattcaagattcgactaagtcca |
2734760 |
T |
|
| Q |
113 |
ttccatcatcgatatcttgtgctagcaagaacccgattgactcatcttttgcgacaatgtacatttttaccggtttacctggtactagcggcacgagtac |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||| |
|
|
| T |
2734761 |
ttccatcatcgatatcttgtgctagcaagaacccgattgactcatcttttgcgacaatgtacaactttaccggtttacctggtactagtggcacgagtac |
2734860 |
T |
|
| Q |
213 |
tggtggattcacaaaggcatacttgatttgcttaaaggtgttatgttttcggctcccc |
270 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
2734861 |
tggtggattcacaaaggcctacttgatttgcttaatggtgttatgttttcggctcccc |
2734918 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University