View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9604_low_31 (Length: 258)
Name: NF9604_low_31
Description: NF9604
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9604_low_31 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 94; Significance: 6e-46; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 94; E-Value: 6e-46
Query Start/End: Original strand, 1 - 102
Target Start/End: Complemental strand, 40844330 - 40844229
Alignment:
| Q |
1 |
tccattaaatcaggaaaaacaaattcctcttgacttttggtattgcagaatgaattaagttagcatttaattaaagtaaatgctaacgcttaatgttcaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||| |
|
|
| T |
40844330 |
tccattaaatcaggaaaaacaaattcctcttgacttttggtattgcagaatgaattaagttagcatttaactaaagtaaatgctaacgcttaatgtgcaa |
40844231 |
T |
|
| Q |
101 |
ga |
102 |
Q |
| |
|
|| |
|
|
| T |
40844230 |
ga |
40844229 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 120 - 152
Target Start/End: Complemental strand, 40844202 - 40844170
Alignment:
| Q |
120 |
atcaataatgtgcaagacttgtttctgtaaaaa |
152 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
40844202 |
atcaataatgtgcaagacttgtttctgtaaaaa |
40844170 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 27 - 83
Target Start/End: Original strand, 46501640 - 46501696
Alignment:
| Q |
27 |
ctcttgacttttggtattgcagaatgaattaagttagcatttaattaaagtaaatgc |
83 |
Q |
| |
|
||||| ||||||||||||| |||||||||||| || ||||||||| | ||||||||| |
|
|
| T |
46501640 |
ctcttcacttttggtattgtagaatgaattaaattggcatttaatcagagtaaatgc |
46501696 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University