View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9604_low_35 (Length: 248)
Name: NF9604_low_35
Description: NF9604
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9604_low_35 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 1 - 242
Target Start/End: Complemental strand, 40260076 - 40259835
Alignment:
| Q |
1 |
tcagggaagaagcatttctttctgtctttcataaaaagcatggaaagttcccgatgtattttgctggctttctttctcaaactcctttgccagttgattc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
40260076 |
tcagggaagaagcatttctttctgtctttcataaaaagcatggaaaattcccgatgtattttgctggctttctttctcgaactcctttgccagttgattc |
40259977 |
T |
 |
| Q |
101 |
tccatggnnnnnnncttttctttctcggctttgtaattcagatttaatcagtgttgataaataacggccatagcggcactatagtgtagcggaattcgta |
200 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40259976 |
tccatggtttttttcttttctttctcggctttgtaattcagatttaatcagtgttgataaataacggccatagcggcactatagtgtagcggaattcgtg |
40259877 |
T |
 |
| Q |
201 |
caaattgctattgttttgtgaaacaccatgttatcaaatagc |
242 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40259876 |
caaattgctattgttttgtgaaacaccatgttatcaaatagc |
40259835 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 148 - 196
Target Start/End: Complemental strand, 12132190 - 12132142
Alignment:
| Q |
148 |
tcagtgttgataaataacggccatagcggcactatagtgtagcggaatt |
196 |
Q |
| |
|
|||||||||||||||| |||| |||| |||||||||| | ||||||||| |
|
|
| T |
12132190 |
tcagtgttgataaatagcggctatagtggcactatagcgaagcggaatt |
12132142 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University