View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9604_low_36 (Length: 245)
Name: NF9604_low_36
Description: NF9604
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9604_low_36 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 1 - 230
Target Start/End: Original strand, 40844312 - 40844546
Alignment:
| Q |
1 |
tttttcctgatttaatggagatgattgggcttatgattagtctcactctcatatgttcataattttgtcannnnnnnn-----ctattggatcctttcac |
95 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
40844312 |
tttttcctgatttaatggagatgattgggcttatgattagtctcactctcatatgttcataattttgtcatttttttttttttctattggatcctttcac |
40844411 |
T |
 |
| Q |
96 |
tttgatttgtttaaatttaaatatacatttcagttgaaatatatgtaaactaccttgtaggaatgatagatgcaagtgtagaatagccaatttaaaatat |
195 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40844412 |
tttgatttgtttaaatttaaatatacatttcagttgaaatatatgtaaactaccttgtaggaatgatagatgcaagtgtagaatagccaatttaaaatat |
40844511 |
T |
 |
| Q |
196 |
acagatttctttcactgtataagatatgtcgattt |
230 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
40844512 |
acagatttctttcactgtataagatatgtcgattt |
40844546 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University