View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9604_low_39 (Length: 236)
Name: NF9604_low_39
Description: NF9604
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9604_low_39 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 1 - 230
Target Start/End: Original strand, 52035778 - 52036003
Alignment:
| Q |
1 |
atatacattgtcgggagagaacttattatctgtgaagcttctacaatattagtatttgtcaacaaaataattcgaagtaattgacannnnnnnataggtg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| | ||| ||| |
|
|
| T |
52035778 |
atatacattgtcgggagagaacttattatctgtgaagcttctacaatattagtatttgtaaacaaaataattcgaagtaattgatatttttt-atacgtg |
52035876 |
T |
 |
| Q |
101 |
ttcttgcaagttgtttggataattgatgaaaagaatgaatgaaaaatgtaagaggatggaattgataaaccactcaatagattacattaaccattattta |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
52035877 |
ttcttgcaagttgtttggataattgatgaaaagaatgaatgaaaaatgtaagaggatggaattgataaaccactcaatagattacattaacc---attta |
52035973 |
T |
 |
| Q |
201 |
accgttttctgtgggaacaggggatgcctc |
230 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
52035974 |
accgttttctgtgggaacaggggatgcctc |
52036003 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University