View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9604_low_45 (Length: 221)
Name: NF9604_low_45
Description: NF9604
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9604_low_45 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 161; Significance: 5e-86; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 23 - 208
Target Start/End: Complemental strand, 41428044 - 41427859
Alignment:
| Q |
23 |
agtaccatccacaaaattaaaatagtttggatgcaaaatgatttagtttttaacttgtaaaacgattgnnnnnnntaattctgcaaagcaaaacccatga |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
41428044 |
agtaccatccacaaaattaaaatagtttggatgcaaaatgatttagtttttaacttgtaaaacgattgaaaaaaataattctgcaaagcaaaacccatga |
41427945 |
T |
 |
| Q |
123 |
ggtagaagcatttgcacaaaattagtacagtataataattctataaagtcacagttaggtgaatcataagcaatttcagaattatc |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41427944 |
ggtagaagcatttgcacaaaattagtacagtataataattctataaagccacagttaggtgaatcataagcaatttcagaattatc |
41427859 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University