View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9605_11 (Length: 315)

Name: NF9605_11
Description: NF9605
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9605_11
NF9605_11
[»] chr1 (1 HSPs)
chr1 (30-310)||(14192354-14192634)


Alignment Details
Target: chr1 (Bit Score: 173; Significance: 5e-93; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 173; E-Value: 5e-93
Query Start/End: Original strand, 30 - 310
Target Start/End: Original strand, 14192354 - 14192634
Alignment:
30 aatacatggacaggtttctgcgtcaagaaaaccagcagcatgaaccagaactattcatgacaatgttaagggcatgtaacgtagatattcccatatttga 129  Q
    |||||||| |||||||||||| |||||||||||||||| ||| ||||| |  ||||   |||| |||||| ||||||| || ||||||||||||||||||    
14192354 aatacatgaacaggtttctgcttcaagaaaaccagcagaatgtaccaggaacattcgacacaaggttaagtgcatgtagcgaagatattcccatatttga 14192453  T
130 aatagacacccgcgcaagctatgatgctagcatcttaggttcagaattaactgcagatgttatcgggagaacaatgatattggatggttgttttctgtta 229  Q
    |||||||| ||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||    
14192454 aatagacatccgcgcaagctatgatggtagcatcttaggttcagaattaactacagatgttatcgggagaaaaatgatattggatggttgttttctgtta 14192553  T
230 cagtttctcagtaaacttaatcagccagcaatagatgccgaagacccaatatttgaaaccagggaaaagatctgtgctgct 310  Q
    ||| ||||||||| |||| | || ||| |||||||| || ||||||||||||||||||||||||||||||| |||||||||    
14192554 cagcttctcagtagacttgaacacccaacaatagatccccaagacccaatatttgaaaccagggaaaagatgtgtgctgct 14192634  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University