View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9605_6 (Length: 363)
Name: NF9605_6
Description: NF9605
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9605_6 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 158; Significance: 5e-84; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 158; E-Value: 5e-84
Query Start/End: Original strand, 26 - 204
Target Start/End: Complemental strand, 6175753 - 6175579
Alignment:
| Q |
26 |
cattacgcaacaactataactagttagttgatgatactttcacaaatccatggcatggaatgggaagagaaggacatggacatggacatggtatggagga |
125 |
Q |
| |
|
||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6175753 |
cattatgcaacaactataactagtt----gatgatactttcacaaatccatggcatggaatgggaagagaaggacatggacatggacatggtatggagga |
6175658 |
T |
|
| Q |
126 |
aagatttgtgtgcgggttttgtatcatatcatttcacgctactcactatcaccaacaccccacgcgccacaataatatc |
204 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6175657 |
aagatttgtgtgcgggttttgtatcatatcatttcacgctactcactatcaccaacaccccacgcgccacaataatatc |
6175579 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 225 - 339
Target Start/End: Complemental strand, 6175020 - 6174906
Alignment:
| Q |
225 |
ataaattattaaatatatttaaaatcaaaattgcacattggcatgtgtgacaaagttaattgtgtcatatagtataacacgaaggaagtaattttgagta |
324 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6175020 |
ataaattattaaatatatttaaaatcaaaattgcacattggcatgtgtgacaaagttaattgtgtcatatagtataacacgaaggaagtaattttgagta |
6174921 |
T |
|
| Q |
325 |
tattgatatttgatg |
339 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
6174920 |
tattgatatttgatg |
6174906 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 32; Significance: 0.000000008; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 225 - 256
Target Start/End: Complemental strand, 23591239 - 23591208
Alignment:
| Q |
225 |
ataaattattaaatatatttaaaatcaaaatt |
256 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
23591239 |
ataaattattaaatatatttaaaatcaaaatt |
23591208 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 225 - 256
Target Start/End: Complemental strand, 23591507 - 23591476
Alignment:
| Q |
225 |
ataaattattaaatatatttaaaatcaaaatt |
256 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
23591507 |
ataaattattaaatatatttaaaatcaaaatt |
23591476 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University