View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9605_8 (Length: 323)
Name: NF9605_8
Description: NF9605
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9605_8 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 127; Significance: 1e-65; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 136 - 294
Target Start/End: Complemental strand, 28191080 - 28190922
Alignment:
| Q |
136 |
aaaaatgaagaagtcatattggctataagagttaggtgtcatcttattaaaatgtagatatcacatcaatgtaaattcgtggaaaactgaattgggacta |
235 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
28191080 |
aaaaatgaagaagtcatattggctataagagttaggtgtcatcttattattaaaatgatatcacatcaatgtaaattcgtgcaaaactgaattgggacta |
28190981 |
T |
|
| Q |
236 |
ccaaattgtaaagaggaaaactataagcacccaagattgctaaaaagatatgtggaacc |
294 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28190980 |
ccaaatcgtaaagaggaaaactataagcacccaagattgctaaaaagatatgtggaacc |
28190922 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 64 - 97
Target Start/End: Complemental strand, 28191151 - 28191118
Alignment:
| Q |
64 |
aaatctctaatcaaggtcttaaatattttggtca |
97 |
Q |
| |
|
||||||||||||||||| |||||||||||||||| |
|
|
| T |
28191151 |
aaatctctaatcaaggttttaaatattttggtca |
28191118 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 38; Significance: 0.000000000002; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 29 - 74
Target Start/End: Original strand, 44203972 - 44204017
Alignment:
| Q |
29 |
agttgtgtctcaatatgagcgaacgaaatattaagaaatctctaat |
74 |
Q |
| |
|
||||||||||||||||| ||||||||||| |||||||||||||||| |
|
|
| T |
44203972 |
agttgtgtctcaatatgggcgaacgaaatgttaagaaatctctaat |
44204017 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University